بررسی اثر ضدمیکروبی گیاه (توربید) Daphne Oleoides روی باکتری‌های جدا شده از پلاک دندانی

نوع مقاله: مقاله پژوهشی

نویسندگان

1 کارشناس ارشد میکروبیولوژی، دانشگاه آزاد اسلامی، واحد بروجرد، لرستان، ایران

2 دکتری تخصصی باکتری شناسی پزشکی، گروه میکروب شناسی پزشکی، دانشکده پزشکی، دانشگاه علوم پزشکی همدان، همدان، ایران

چکیده

مقدمه: حفره دهانی محیط مطلوبی برای رشد و کلونیزاسیون طیف گسترده ای از باکتری ها می باشد. پلاک یا بیوفیلم دندانی به مجموعه ای متنوع از باکتری ها اطلاق می شود که بر روی سطح دندان یافت می شوند. هدف از این مطالعه، بررسی اثر ضدمیکروبی گیاه توربید Daphne Oleoidesروی باکتری‌های جدا شده از پلاک دندانی بود.
مواد و روش ها:این مطالعه مقطعی، پس از جمع آوری پلاک های دندانی، جداسازی باکتری های موجود در نمونه ها، شناسایی باکتری ها توسط تست های بیوشیمیایی و واکنش زنجیره پلیمراز (Polymerase Chain Reaction) صورت گرفت. برگ و ساقه گیاه D.Oleoidesدر فصل های رویش جمع آوری و در سایه خشک شد. عصاره آبی، الکلی و هیدروالکلی این گیاه با روش عصاره‌گیری کلاسیک استخراج شد. سپس اثرات ضد میکروبی آن با روش انتشار دیسک و حداقل غلظت مهار کنندگی مورد بررسی قرار گرفت. تجزیه و تحلیل داده ها با استفاده ازآزمون کروسکال-والیس و Dunn انجام شد (05/0a=).
یافته ها:در پلاک های دندانی جمع آوری شده، حضور باکتری های استافیلوکوکوس اورئوس، استافیلوکوکوس اپیدرمیدیس، سودوموناس آئروجینوزا و استرپتوکوکوس موتانس به اثبات رسید. عصاره الکلی بیشترین فعالیت ضدمیکروبی خود را علیه باکتری استرپتوکوکوس موتانس با قطر هاله عدم رشد 05/1±55/20 میلی متر و کمترین غلظت کشندگی 19/0 میلی گرم بر میلی لیتر نشان داد. از سویی کمترین توان ضدمیکروبی عصاره الکلی علیه باکتری استافیلوکوکوس اپیدرمیدیس با قطر هاله عدم رشد 5/0±4/7 میلی متر و غلظت 5/12 میلی گرم بر
میلی لیتر نشان داده شد(05/0P<).
نتیجه گیری: نتایجتحقیقحاضرنشاندادکهعصاره الکلیگیاه D.Oleoides تواناییاستخراجترکیباتآنتیباکتریاییبر ضد باکتری های ایجاد کننده عفونت های دهانی را دارد.

کلیدواژه‌ها


عنوان مقاله [English]

Antimicrobial Effect of Extracts of Daphne Oleoides on Bacteria Isolated from Dental Plaque

نویسندگان [English]

  • Fatemeh Mousavi 1
  • Kolsoom Shirzadi Karamolah 1
  • Hassan Mahmoudi 2
1 Master of Microbiology, Islamic Azad University, Boroujerd Branch, Lorstan, Iran
2 Ph.D. of Medical Microbiology, Microbiology Department, Hamadan University of Medical Sciences, Hamadan, Iran
چکیده [English]

Introduction: Oral cavity a favorable environment for the growth and colonization of a wide range of bacteria. Plaques or dental biofilms are a wide variety of bacteria found on a tooth surface. The aim of the present study is to investigate the antibacterial effect of Daphne Oleoides on bacteria isolated from dental plaque.
Materials and Methods: In this cross-sectional study, after the collection of dental plaques and isolation of bacteria, bacteria were identified using biochemical tests and Polymerase chain reaction (PCR).  Leaves and stems of D. oleoides were collected in the growing season and dried in shadows. The aqueous, alcoholic and hydroalcoholic extracts of D. oleoides were withdrawn using the classical extraction method. Thereafter, its antimicrobial effects on bacteria isolated from dental plaque were examined using the disk diffusion method and minimum inhibitory concentration (MIC). Data were analyzed using Turkey’s and Anova test (P<0.05).
Results: The obtained results of the present study confirmed the presence of Staphylococcus aureus, Staphylococcus epidermidis, Pseudomonas aeruginosa, Streptococcus mutans in the collected dental plaques. The alcoholic extract demonstrated its highest antimicrobial activity against S. mutans with 20.55±1.05 mm inhibition zone and a Minimum lethal concentration (MLC) of 0.19 mg/ml. On the other hand, the lowest antimicrobial activity of the alcoholic extract was reported to be against S. epidermidis with 7.4±0.5 mm inhibition zone and MLC 12.5 mg/ml.
Conclusion: The results of the current study indicated that the alcoholic extract of D. oleoides is able to withdraw antibacterial compounds on the bacteria which are responsible for oral infections.

کلیدواژه‌ها [English]

  • Dental plaque
  • Minimum inhibitory concentration (MIC)
  • Daphne Oleoides

مقدمه

حفره دهانی محیط مناسبی برای رشد و کلونیزاسیون طیف وسیعی از باکتری ها می باشد. پلاک یا بیوفیلم دندانی، اشاره به مجموعه ای متنوع از باکتری ها دارد که بر روی سطح دندان یافت می شوند. اگر پلاک دندانی به طور کامل برداشته نشود پوسیدگی دندان رخ خواهد داد.(2و1) پوسیدگی دندانی ناشی از تخریب ساختارهای دندانی توسط اسید تولید شده از سوخت و ساز کربوهیدارت ها توسط باکتری های بی هوازی موجود در پلاک دندانی می باشد.(3) ساکنین اولیه پلاک دندانی از جمله استافیلوکوکوس ارئوس، باکتری های هوازی می باشند که با مصرف اکسیژن و کاهش پتانسیل اکسیداسیون و احیاء شرایط مساعد را برای رشد باکتری های بی هوازی فراهم می نمایند.(4) امروزه مقاومت باکتریایی نسبت به آنتی‌بیوتیک‌ها به صورت یک معظل جهانی در امر درمان بیماری‌های عفونی درآمده است. از این جهت در سالیان اخیر استفاده از گیاهان دارویی به علت عوارض کمتر آنها مورد توجه قرار گرفته است.(5)مشکل مقاومت به آنتی‌بیوتیک‌ها به دلایل مختلف از جمله مصرف بی رویه و نامناسب آنها اتفاق می افتد. مقاومت آنتی بیوتیکی نه تنها باعث افزایش مرگ و میر می‌شود بلکه موجب تلاش برای ساخت آنتی‌بیوتیک‌های جدید می شود. که مشکل این نوع آنتی بیوتیک های جدید هزینه بسیار بالای آنهاست.(7و6)  با توجه به اثراتمفید گیاهان دارویی در درمان بیماری ها و با توجه به دردسترس بودن و سازگاری بیشتر آنها با سیستم ایمنی انسان،استفاده از گیاهان و مواد مؤثره آن ها در مقابله با عوارضجانبی ناشی از مصرف داروهای شیمیایی رو به افزایش است.(9و8) ایران از لحاظ آب و هوا، موقعیت جغرافیایی و زمینه رشد گیاهان دارویی یکی از بهترین مناطق جهان محسوب می‌گردد.(10)گونه‌های دافنه متعلق به خانواده تیمیلاسه است که دارای 50 تیره و در حدود 500 گونه می‌باشد. این گیاه بوته‌ای معمولاً در آب و هوای گرم و استوایی و به ویژه در نواحی جنوبی آفریقا، مدیترانه و به میزان کمتر در آمریکای جنوبی وجزایر اقیانوس آرام می‌روید. در پاکستان و ایران 5 تیره و7 گونه از آن وجود دارد.(11) مطالعات متعددی نشان داده اند که گونه‌های دافنه (Daphne oleoides و Daphne genkwa) به عنوان تولیدکننده های محصولات طبیعی مانند کومارین‌ها، لیگنان، تریترپنوئیدهاو کومارینولیگانان‌ها شناخته می‌شوند. گیاهان گونه دافنه در طب به خوبی شناخته شده اند و در طب سنتی برای درمان زخم معده، رماتیسم و پوسیدگی و درد دندان، گنوره آ و سرطان استفاده می‌شود.(13و12)در بین گونه های دافنه، گونهD.Oleoides  دارای اثرات درمانی فراوانی می باشد.(13) با توجه به اینکه تاکنون بر روی اثر ضدباکتریایی عصاره این گیاه بر روی باکتری‌های دهان و باکتری های جدا شده از عفونت های بیمارستانی تحقیقاتی جامع و کامل انجام نشده است، بنابراین بررسی اثر ضدباکتریایی این گیاه ضرورت دارد تا شاید بتوان درآینده از آن به عنوان جایگزین و یا مکمل داروهای سنتتیک و دهان شویه‌های شیمیایی استفاده نمود.

مواد و روش ها

در این مطالعه مقطعی، نمونه های پلاک دندانی از مراجعین به کلینیک های دندان پزشکی بروجرد جمع آوری شد. نمونه ها بلافاصله در لوله های حاوی 2 میلی لیتر فسفات بافر سالین قرار داده شده و به آزمایشگاه میکروبیولوژی دانشگاه آزاد بروجرد منتقل شدند.

کلیه نمونه ها پس از هموژن شدن، بر روی محیط آگار خون دار و مک کانکی آگار، کشت داده شدند. پلیت ها در دمای 37 درجه سانتی گراد به مدت 24 تا 48 ساعت در شرایط هوازی و بی هوازی (داخل جار بی هوازی) انکوبه شدند. به منظور تأیید کلنی های مشکوک رشد کرده بر روی محیط های کشت مورد نظر، لام میکروسکوپی تهیه و رنگ آمیزی گرم انجام شد. بر روی باکتری های گرم منفی و گرم مثبت جدا شده تست های بیوشیمیایی کاتالاز، اکسیداز و تخمیر قندهای مانوز، سوربیتول، سالیسین، هالوز، لاکتوز و مانیتول، بررسی الگوی همولیز در محیط آگار خون دار و تست اکسیداسیون- تخمیر انجام و باکتری تعیین هویت گردید.(14)

ژنوم سویه های جدا شده از پلاک های دندانی که شامل باکتری های استافیلوکوکوس اورئوس، استافیلوکوکوس اپیدرمیدیس، استرپتوکوکوس موتانس، و سودوموناس آئروژینوزا بود، از کشت های 24 ساعته این باکتری ها و طبق دستورالعمل شرکت  سازنده کیّت (Bioflux Japan) استخراج گردید. سپس DNA استخراج شده در فریزر 20- درجه سیلسیوس ذخیره گردید. برای تأیید هویت
باکتری های استافیلوکوکوس اورئوس، استافیلوکوکوس اپیدرمیدیس، استرپتوکوکوس موتانس، و سودوموناس آئروژینوزا به ترتیب ژن های nuc، gseA، gtf و las I شناسایی شدند. برای انجام واکنش PCR، 2 میکرولیتر DNA استخراج شده به 18 میکرولیتر از مخلوط واکنش PCR (Master Mix . شرکت آمپلیکون) اضافه گردید. به منظور تکثیر ژن های nuc، gseA، gtfB و las I از پرایمرهای جدول 1 استفاده شد.


 جدول 1 : پرایمرهای مورد استفاده در این مطالعه

باکتری مورد مطالعه

ژن ها

توالی پرایمر

دمای ذوب

سانتی گراد

اندازه

جفت باز

رفرانس

استافیلوکوکوس اورئوس

nuc

F

AGCCAAGCCTTGACGAACTAAAGC

55

279

15

R

GCGATTGATGGTGATACGGTT

استافیلوکوکوس اپیدرمیدیس

gseA

F

ATGAAAAAGAGATTTTTATCT

50

503

16

R

GTTTGGTGACACTCTTAAG

استرپتوکوکوس موتانس

gtf B

F

ACT ACA CTT TCG GGT GGC TTG G

58

517

17

R

CAG TAT AAG CGC CAG TTT CAT C

سودوموناس آئروژینوزا

opr L

F

ATGGAAATGCTGAAATTCGGC

57

504

18

R

CTTCTTCAGCTCGACGCGACG

 

جمع آوری گیاه مورد مطالعه

برگ و ساقه گیاه D.Oleoides از مراتع استان لرستان در فصل های رویش جمع آوری شد. پس از تأیید نام علمی در آزمایشگاه فارماکوگنوزی دانشکده داروسازی لرستان، به این گیاهان شماره هرباریومی 54 تعلق گرفت. پس از تأیید علمی و تشخیص گونه (D.Oleoides Schreb. oleoides  جزءخانوادهThymelaeaceae) مورد نظر، برگ و پوست ساقه این گیاه بعد از برطرف نمودن ناخالصی‌ها در معرض هوا و در سایه، پهن و به دور از تابش مستقیم نور خورشید خشک و نگهداری شد. (تصویر 1)

تهیه عصاره های آبی و الکلی و هیدروالکلی

جهت عصاره‌گیری، ابتدا به میزان 1 گرم پودر وزن شد، که این میزان نسبت 1 به 10 بین گیاه و حلال بوده است. سپس حلال‌های اتانول مطلق و آب و هیدروالکل (به نسبت 70 سی‌سی اتانول و 30 سی‌سی آب مقطر) به مقدار 10 سی‌سی به هر کدام از پودرها اضافه شد. سپس به مدت 10 ساعت روی شیکرقرار داده شد و پس از آن به مدت 14 ساعت در دمای یخچال قرار داده شد و بعد از خارج کردن آنها از یخچال با استفاده از کاغذ صافی واتمن شماره 1 تفاله و ناخالصی گیاه گرفته شد و پس از آن با استفاده از فیلتر سرسرنگی مجدداً به ظروف شیشه ی انتقال داده شد.(19) به منظور حذف حلال، عصاره های حاصل در دستگاه روتاری تحت عملیات تقطیر در خلأ قرار گرفتند.

حلال موجود در عصاره حاصل از روش های مختلف استخراج توسط دستگاه تبخیر در خلأ چرخشی تبخیر و در آون تحت خلأ خشک گردید. با محاسبه وزن اولیه بالن و وزن نهایی آن که حاوی ماده خشک بر جای مانده بود، مقدار کل ماده خشک استخراج شده در مرحله استخراج محاسبه شد و به صورت درصد (گرم به صد گرم نمونه خشک) بیان گردید .

آماده سازی باکتری ها برای کشت

از سوش های میکروبی ایزوله شده از پلاک های دندانی، کشت داده شد. بعد از رشد باکتری ها بر روی محیط مولر هینتون آگار، یک لوپ از کلونی باکتری به یک میلی لیتر BHI broth  (Brain Heart infusion broth) انتقال و در دمای 37 درجه سیلیسیوس به مدت 24 ساعت انکوبه شد. همچنین غلظت سوسپانسیون میکروبی با کدورت معادل استاندارد 5/0 مک فارلند (108×5/1) باکتری در هر میلی­لیتر در محیط BHI broth تهیه شد.(19)


 

 

تصویر 1 : نمونه های گرفته شده از برگ و ساقه گیاهD. Oleoides (کوه های روستای قلعه نصیر استان لرستان)


بررسی فعالیت ضد میکروبی عصاره   Daphne Oleoides به روش انتشار دیسک و رقت در آگار سوسپانسیون میکروبی با کدورت معادل استاندارد 5/0 مک فارلند (108×5/1) باکتری در هر میلی­لیتر در محیط BHI broth تهیه شد. سپس از این سوسپانسیون بر روی محیط Mueller Hinton Agar (MHA) کشت داده شد. دیسک های آماده شده از غلظت های مختلف با رعایت شرایط آنتی بیوگرام بر روی محیط قرار داده شدند. از دیسک های حاوی دی متیل سولفوکساید (دی متیل سولفوکساید) به عنوان کنترل منفی و از دیسک های آنتی بیوتیکی (پنی سیلین 10 میکروگرمی، ونکومایسین 30 میکروگرمی، جنتا مایسین 10 میکروگرمی ) به عنوان کنترل مثبت استفاده گردید. پلیت­ها 24 ساعت در دمای  37 درجه انکوبه گردیدند و بعد از آن خواص ضد باکتریایی عصاره های برگ و ساقه گیاه مورد ارزیابی قرار گرفتند.(19)

بررسی فعالیت ضدمیکروبی عصاره  D.Oleoides به روش حداقل غلظت مهاری (Minimal Inhibitory Concentration) MIC

آزمون تعیین حداقل غلظت مهارکنندگی به روش رقت مایع (میکرو براث دایلوشن) صورت گرفت. از سوسپانسیون نیم مک فارلند تهیه شده از کشت یک شبه ی میکروارگانیسم ها، رقت های یک دهم و سپس یک صدم تهیه گردید تا تعداد تقریبی 106 میکروارگانیسم در هر میلی لیتر از سوسپانسیون ایجاد شود. از رقت های متوالی 10 تا 0195/0 میلی گرم در هر میلی لیتر هر یک از عصاره ها که قبلاً تهیه شده بود، 200 میکرولیتر به چاهک های شماره 1 تا 10 یک میکرو پلیت 96 خانه ای استریل منتقل شد. در هر پلیت، 20 میکرولیتر از سوسپانسیون میکروبی اضافه شد و در نهایت همه ی پلیت ها به انکوباتور 37 درجه سانتی گراد منتقل و پس از 24 ساعت برای تعیین MIC بررسی گردیدند. آزمون به صورت سه بار تکرار انجام شد. برای تعیین MIC عصاره ها، از محلول mg/ml 5 تری فنیل تترازولیوم کلراید استفاده شد. پس از اضافه نمودن رنگ تترازولیوم، پلیت‌ها به مدت یک ساعت در انکوباتور قرار داده شدند. پس از یک ساعت پلیت‌ها از انکوباتور خارج گردید. خانه‌هایی که رنگ قرمز در آن‌ها ایجاد شده بود، نشانه آن بود که در این خانه‌ها باکتری رشد کرده است و خانه‌هایی که به رنگ سبز یا زرد باقی مانده بودند، نشانه آن بود که باکتری در این خانه‌ها رشد نکرده بود. چاهک شاهد مثبت شامل محیط کشت و سوسپانسیون باکتری و چاهک شاهد منفی حاوی محیط کشت و عصاره بود.(20و19)

از نرم افزار SPSS  با ویرایش 20 آزمون های کروسکال والیس و Dunn برای آنالیز داده های بدست آمده استفاده شد.

یافته ها

از بین پلاک های دندانی جمع آوری شده، براساس نتیجه ی آزمایش PCR حضور باکتری های استافیلوکوکوس اورئوس، استافیلوکوکوس اپیدرمیدیس، استرپتوکوکوس موتانس، سودوموناس آئروژینوزا تأیید شد. (تصویر 2)


 

 

 

تصویر 2 : ژل الکتروفورز محصولات PCR  ژن های تأییدی برای باکتری های مورد مطالعه: چاهک شماره 1 کنترل منفی،

چاهک شماره 2 محصول PCR ژن nuc برای تأیید استافیلوکوکوس اورئوس ، چاهک شماره 3 محصول PCR ژن gse A برای تأیید استافیلوکوکوس اپیدرمیدیس، چاهک شماره 4 محصول PCR ژن opr L  برای تأیید سودوموناس آئروژینوزا، چاهک شماره 5 محصول PCR ژن gtf B   برای تأیید استرپتوکوکوس موتانس، چاهک M، مارکر DNA، 100 bp

 

نتایج بدست آمده در روش دیسک دیفیوژن برای گیاه D.Oleoides در جدول 3 و 2 شرح داده شده است. عصاره الکلی گیاه D.Oleoides بیشترین قطر هاله عدم رشد را در باکتری ایجاد نمود، که در این میان بیشترین قطر هاله عدم رشد تشکیل شده مربوط به باکتری استرپتوکوکوس موتانس 05/1±55/20بود. در عصاره آبی هیچ گونه هاله عدم رشدی تشکیل نداد. عصاره الکلی بیشترین حساسیت را باکتری استرپتوکوکوس موتانس در غلظت (19/0 میلی‌گرم برمیلی‌لیتر) و کمترین حساسیت را باکتری استافیلوکوکوس اورئوس در غلظت (5/12 میلی‌گرم بر میلی‌لیتر) از خود نشان دادند. عصاره هیدروالکلی بیشترین حساسیت را باکتری استرپتوکوکوس موتانس (25/6 میلی‌گرم بر میلی‌لیتر) و کمترین حساسیت را باکتری استافیلوکوکوس اورئوس و سودوموناس آئروجینوزا در غلظت (5/12 میلی‌گرم بر میلی‌لیتر) از خود نشان دادند. عصاره آبی نسبت به هیچ‌یک از باکتری‌ها از خود خاصیت میکروبی نشان نداد و باکتری‌ها در تمامی غلظت‌ها توانستند رشد کنند. (جدول 4 و تصویر 3)


جدول 2 : نتایج رقت های مختلف عصاره های الکلی D.Oleoides

رقت های عصاره

میانگین و انحراف معیار هاله عدم رشد (میلی گرم/میلی لیتر)

عصاره الکلی ساقه

عصاره الکلی برگ

عصاره آبی برگ

 

D

C

B

A

D

C

B

A

D

C

B

A

100

25/1±25/8

41/0±6/9

9/3±5/5

4/1±9/8

35/1±35/10

0

5/0±4/7

5/0±5/7

0

0

0

0

50

24/1±25/11

6/1±62/10

05/0±15/11

45/1±95/11

2±14

1/1±4/6

7/2±8/3

81/0±13

0

0

0

0

25

15/1±25/13

60/0±9/12

44/0±05/15

32/0±67/13

95/0±75/15

2/2±7/9

4/0±5/9

5/0±5/14

0

0

0

0

5/12

19/0±8/14

9/1±8/14

55/0±15/16

87/0±87/14

8/0±7/18

7/2±2/12

35/0±12

4/0±6/15

0

0

0

0

25/6

90/0±9/17

62/0±3/17

25/1±25/18

5/0±3/18

05/1±55/20

2±14

04/0±05/14

3/0±5/17

0

0

0

0

کنترل مثبت

پنی سیلین

0

0

47/0±6/17

47/0±6/17

0

0

47/0±6/17

47/0±6/17

 

 

47/0±6/17

47/0±6/17

جنتامایسین

0

09/0±1/25

0

0

0

09/0±1/25

0

0

 

09/0±1/25

0

0

ونکومایسین

08/0±2/14

0

0

0

08/0±2/14

0

0

0

08/0±2/14

0

0

0

کنترل منفی (DMSO)

0

0

0

0

0

0

0

0

0

0

0

0

A: استافیلوکوکوس اورئوس                         B: استافیلوکوکوس اپیدرمیدیس                    C: سودوموناس آئروجینوزا                           D: استرپتوکوکوس موتانس   

DMSO: Dimethyl sulfoxide

 

جدول 3 : نتایج رقت های مختلف عصاره های هیدروالکلی D.Oleoides

رقت های عصاره

میانگین و انحراف معیار هاله عدم رشد (میلی گرم/میلی لیتر)

عصاره هیدروالکلی ساقه

عصاره هیدرو الکلی برگ

عصاره آبی برگ

 

D

C

B

A

D

C

B

A

D

C

B

A

100

05/1±65/7

04/0±75/9

2/0±8/7

9/0±6/7

25/1±75/8

7/3±33/5

9/2±1/4

16/2±16/7

0

0

0

0

50

6/2±6/10

4/0±6/11

1/2±87/11

1±2/12

75/1±25/11

36/0±96/8

51/3±96/4

35/0±65/11

0

0

0

0

25

05/3±05/13

30/0±4/14

35/0±85/15

09/0±1/14

62/0±37/14

54/0±55/10

7/2±7/9

20/0±2/13

0

0

0

0

5/12

9/2±9/15

65/0±15/16

39/0±6/17

10/0±9/16

45/1±95/16

25/0±25/14

75/0±75/13

19/0±3/15

0

0

0

0

25/6

87/2±87/16

25/0±75/17

64/1±33/14

37/0±12/18

75/0±25/18

5/0±5/16

25/0±75/16

64/0±85/16

0

0

0

0

کنترل مثبت

پنی سیلین

0

0

47/0±6/17

47/0±6/17

0

0

47/0±6/17

47/0±6/17

 

 

47/0±6/17

47/0±6/17

جنتامایسین

0

09/0±1/25

0

0

0

09/0±1/25

0

0

 

47/0±6/17

0

0

ونکومایسین

08/0±2/14

0

0

0

08/0±2/14

0

0

0

09/0±1/25

0

0

0

کنترل منفی (DMSO)

0

0

0

0

0

0

0

0

0

0

0

0

A: استافیلوکوکوس اورئوس                         B: استافیلوکوکوس اپیدرمیدیس                    C: سودوموناس آئروجینوزا                           D: استرپتوکوکوس موتانس   

DMSO: Dimethyl sulfoxide

جدول 4 : نتایج حداقل غلظت مهاری عصاره های الکلی، هیدروالکلی و آبی سویه های مورد مطالعه در بهار و تابستان

نمونه های جمع آوری شده

        عصاره

حداقل غلظت مهاری (میلی گرم/میلی لیتر)

استرپتوکوکوس موتانس

سودوموناس آئروجینوزا

استافیلوکوکوس اپیدرمیدیس

استافیلوکوکوس اورئوس

برگ در فصل بهار

عصاره الکلی

56/1

25/6

12/3

5/12

عصاره هیدروالکلی

25/6

5/12

25/6

5/12

عصاره آبی

100

100

100

100

ساقه در فصل بهار

عصاره الکلی

56/1

25/6

12/3

5/12

عصاره هیدروالکلی

25/6

5/12

25/6

5/12

عصاره آبی

100

100

100

100

برگ و ساقه در فصل بهار

عصاره الکلی

19/0

5/12

12/3

25/6

عصاره هیدروالکلی

25/6

5/12

25/6

5/12

عصاره آبی

100

100

100

100

برگ در فصل تابستان

عصاره الکلی

56/1

25/6

12/3

25/6

عصاره هیدروالکلی

5/12

5/12

25/6

5/12

عصاره آبی

100

100

100

100

ساقه در فصل تابستان

عصاره الکلی

56/1

25/6

12/3

25/6

عصاره هیدروالکلی

5/12

5/12

25/6

5/12

عصاره آبی

100

100

100

100

برگ و ساقه در فصل تابستان

عصاره الکلی

56/1

25/6

12/3

25/6

عصاره هیدروالکلی

5/12

5/12

25/6

5/12

عصاره آبی

100

100

100

100

 

 

 

 

تصویر 3 : نتایج تأثیر رقت های مختلف عصاره گیاه D.Oleoides بر روی سویه های مورد مطالعه

الف: سودوموناس آئروجینوزا (ATCC10205) (عصاره الکلی ساقه D. oleoides در فصل بهار)

ب: استرپتوکوکوس موتانس (ATCC 10672) (عصاره الکلی برگ D. oleoides در فصل بهار)

ج: استرپتوکوکوس موتانس (ATCC 10672) (عصاره الکلی ساقه D. oleoides در فصل تابستان)

ت: استافیلوکوکوس اپیدرمیدیس (ATCC12228) (عصاره الکلی برگ D. oleoides در فصل بهار)

ث: استرپتوکوکوس موتانس (ATCC 10672) (عصاره الکلی برگ D. oleoides در فصل تابستان)

چ: استافیلوکوکوس اورئوس (ATCC 10690) (عصاره الکلی برگ D. oleoides در فصل بهار)


نتایج شمارش باکتری ها نشان داد که با افرایش غلظت عصاره الکلی و هیدروالکلی گیاه D.Oleoides میزان کشتن باکتری ها نیز افزایش پیدا کرد، بطوریکه عصاره الکلی برگ D.Oleoides در فصل بهار و تابستان به ترتیب 10log 4 و 10 log8/3باکتری استرپتوکوکوس موتانس را کاهش داد (تصویر 4).

 

 

 

 

 

تصویر 4 : نتایج شمارش باکتری ها (Colony-forming unit /ml)  در غلظت های مختلف عصاره الکلی و هیدروالکلی D.Oleoides

الف: تأثیر عصاره الکلی و هیدروالکلی برگ (فصل رویش بهار) بر استرپتوکوکوس موتانس

ب: تأثیر عصاره الکلی و هیدروالکی برگ (فصل رویش بهار) بر استرپتوکوکوس موتانس

پ: تأثیر عصاره الکلی و هیدروالکی برگ (فصل رویش بهار) بر استافیلوکوکوس اورئوس

ت: تأثیر عصاره الکلی و هیدروالکی برگ (فصل رویش تابستان) بر استافیلوکوکوس اورئوس

ث: تأثیر عصاره الکلی و هیدروالکی برگ (فصل رویش بهار) بر استافیلوکوکوس اپیدرمیدیس

ج: تأثیر عصاره الکلی و هیدروالکی برگ (فصل رویش تابستان) بر استافیلوکوکوس اپیدرمیدیس

چ: تأثیر عصاره الکلی و هیدروالکلی برگ (فصل رویش بهار) بر سودوموناس آئروجینوزا

ح: تأثیر عصاره الکلی و هیدروالکلی برگ (فصل رویش تابستان) بر سودوموناس آئروجینوزا

 


نتایج آنالیز آماری با تست Dunnنشان داد که بین گروه های تیمار شده با عصاره الکلی و هیدروالکلی برگ، نسبت به گروه تیمار شده با عصاره الکلی و هیدروالکلی ساقه، تفاوت معناداری وجود داشت. همچینین این تفاوت معنادار در آنالیز بین گروهی هم مشاهده شد (جدول 5).

بحث

استفاده از ﮔﻴﺎهان دارویی در درمان ﺑﻴﻤﺎری ﻫﺎ ﺑﻪ وﻳﮋه بیماری‌ﻫﺎی ﻋﻔﻮﻧﻲ در ﺳﺎل ﻫﺎی اﺧﻴﺮ روﻧﺪ رو ﺑﻪ رشدی داشته است. همچنین به دلیل داشتن عوارض کمتر در مقایسه با داروﻫﺎی ﺷﻴﻤﻴﺎﻳﻲ ﺑﻄﻮر ﻗﺎﺑﻞ ﻣﻼﺣﻈﻪ ای نظر پژوهشگران را به خود جلب کرده است.(21) اﻣﺮوزه ﺑﺎ ﭘﻴﺸﺮﻓﺖ‌ﻫﺎی بدست آمده در ﺷﻴﻤﻲ آﻟﻲ و ﺗﺤﻮﻻت ﭼﺸﻤﮕﻴﺮ در روش‌ﻫﺎی اﺳﺘﺨﺮاج، ﺗﺨﻠﻴﺺ و ﺗﻌﻴﻴﻦ ﺳﺎﺧﺘﻤﺎن ﺗﺮﻛﻴﺒﺎت ﻃﺒﻴﻌﻲ ﮔﻴﺎﻫﺎن، ارزش داروﻫﺎی ﺣﺎﺻﻞ از ﻣﻨﺎﺑﻊ ﮔﻴﺎﻫﻲ روز ﺑﻪ روز آﺷﻜﺎرﺗﺮ ﺷﺪه ﺑﻪ طوری ﻛﻪ در ﺣﺎل ﺣﺎﺿﺮ ﺣﺪود ﻳﻚ ﺳﻮم ﺗﺎ ﻧﻴﻤﻲ از ﻓﺮآورده‌ﻫﺎی داروﻳﻲ ﻣﻮﺟﻮد در آﻣﺮﻳﻜﺎ دارای ﻣﻨﺸﺎء ﮔﻴﺎﻫﻲ ﻫﺴﺘﻨﺪ.(22)


                                                          جدول 5 : میانگین و انحراف معیار هاله عدم رشد بر حسب گروه ها

گروه ها

نام گروه ها

انحراف معیار

میانگین

نتیجه آزمون کروسکال والیس

P-value

1

تیمار شده با عصاره الکلی (برگ)

272/4

75/20

025/0

2

تیمار شده با عصاره هیدروالکلی (برگ)

252/5

75/17

3

تیمار شده با عصاره آبی (برگ)

0

0

1

تیمار شده با عصاره الکلی ( ساقه)

3/3

375/18

046/0

2

تیمار شده با عصاره هیدروالکلی ( ساقه)

69/2

308/17

3

تیمار شده با عصاره آبی (ساقه)

0

0

 


ﺑﺴﻴﺎری از ﺧﻮاص ﺿﺪﻣﻴﻜﺮوﺑﻲ ﻋﺼﺎره های ﮔﻴاهی ﺑﻪ ﻋﻠﺖ وجود ﻣﻮادی ﻫﻤﺎﻧﻨﺪ ﺗﺎﻧﻦ‌ﻫﺎ، ﺗﺮﻛﻴﺒﺎت ﻓﻨﻮﻟﻲ و ترکیباتی نظیر آن ها ﻣﻲ ﺑﺎﺷﺪ که در ﻗﺴﻤﺖ ﻫﺎی ﻣﺨﺘﻠﻒ ﮔﻴﺎﻫﺎن ﻧﻈﻴﺮ رﻳﺸﻪ، ﺑﺮگ، ﺟﻮاﻧﻪ‌ﻫﺎ، ﻧﻬﺎل و ﭘﻮﺳﺖ وﺟﻮد دارد. فعالیت ضدمیکروبی گیاهان به شرایط محیطی که گیاه در آن می‌روید، نوع حلال و روش عصاره‌گیری، روش بررسی فعالیت های ضدمیکروبی و میکروارگانیسم‌های مورد مطالعه بستگی دارد. ویژگی یک حلال خوب شامل سمیت کم، سهولت تبخیر در دمای کم و ناتوانی در ایجاد کمپلکس با ترکیبات و تفکیک آن است.(23)مطالعات مختلفی اثر ضدباکتریایی گونه های Daphne را به اثبات رسانده اند. از این مطالعات می توان مطالعه جاوید نیا و همکاران(24) را نام برد، که فعالیت ضدباکتریایی عصاره اتانولی ریشه، ساقه و برگ گیاه خوشک (D.Mucronata) علیه باکتری های باسیلوس سوبتلیس، اشریشیا کلی، سودوموناس آئروژینوزا و استافیلوکوکوس اورئوس را گزارش کردند. طبق نتایج این گروه، عصاره ریشه در مقایسه با عصاره های دیگر دارای اثر قویتری روی باکتری های استافیلوکوکوس اورئوس و باسیلوس سوبتیلیس بوده است. نتایج این مطالعه بر روی باکتری های استاندارد بوده ولی مطالعه حاضر بر روی باکتری هایی که از کلینیک جدا شده نیز، انجام گرفته است. لذا اختلاف نتایج می تواند به دلیل نوع گونه های باکتریایی و نیز اختلاف در نوع ترکیبات موجود در گیاهان مورد آزمایش باشد.(8)در مطالعه دیگر توسط Tayob و همکاران(8)، اثر ضدباکتریایی عصاره اتانولی گل، برگ و ساقه گیاه سیاه گینه (Daphne Oleofolia Lam) علیه باکتری های اشریشیا کلی، باسیلوس و سودوموناس بررسی شد. براساس نتایج این مطالعه، عصاره گل بیشترین حساسیت و مقاومت را به ترتیب بر روی باکتری های باسیلوس و اشریشیا کلی نشان داد. در تحقیق حاضر نیز عصاره الکلی و هیدروالکلی گیاه توربید بر روی باکتری های مختلف مورد مطالعه، اثر بازدارندگی بسیار خوبی نشان داد، اما میزان بازدارندگی عصاره آبی گیاه بر روی رشد باکتریها کمتر بود، که این اختلاف می تواند به دلیل تفاوت در نوع ترکیبات موثره مختلف در دو جنس گیاه باشد.(24)

بر اساس نتایج این مطالعه، استرپتوکوکوس موتانس بالاترین حساسیت نسبت به گیاه توربید را در مقایسه با سایر باکتری‌ها نشان داد. شیرزادی و همکاران(19)، به ارزیابی فعالیت ضد میکروبی عصاره های آبی، هیدروالکلی و الکلی برگ و ساقه Daphne Mucronata علیه باکتری های ایجاد کننده عفونت های دهان پرداختند. نتایج آنها نشان داد که بیشترین خاصیت ضد میکروبی مربوط به عصاره الکلی گیاه خوشک (D.Mucronata) بود. در بین باکتری های مورد مطالعه، استرپتوکوکوس موتانس دارای بیشترین حساسیت نسبت به عصاره الکی گیاه (D.Mucronata) بود.(19)

در آزمایشاتی که Manojlovic و همکاران(25) روی عصاره متانولی  D.Cneorumانجام دادند، ترکیب 7 و 8 دی هیدروکسی کومارین که یکی از متابولیت های ثانویه این گیاه است و در گذشته آن را Daphnetin می نامیدند، از عصاره متانولی برگ، جدا و دارای خاصیت ضد میکروبی شناخته شده بود که با آزمایش مورد مطالعه ما همخوانی ندارد. با توجه به نتایج بدست آمده، برخی از تفاوت ها را می توان به دلیل نحوه عصاره گیری، نحوه انجام آزمایش، نوع و گونه گیاهان و حتی رویشگاه طبیعی آنها دانست.

خسروی و همکاران(26)، اثرات ضدباکتریایی گیاه Daphne gnidium L را ارزیابی کردند. نتایج آنها نشان داد که  بیشترین تأثیرگذاری را عصاره ساقه گیاه Daphne gnidium L  بر روی میکروارگانیسم‌ها دارد که مشابه نتایج این مطالعه بود. در ساقه D.Gnidium L.، 4 کومارین و 7 فلاونوئید وجود دارد که می‌توان فعالیت ضدباکتری دافنه را به این ترکیبات نسبت داد.

در همین راستا، مطالعه Cottigli و همکاران(27) فعالیت آنتی‌میکروبیال ساقه Daphne ginidium را به دلیل ترکیباتی همچون کومارین‌ها و فلاونوئیدها دانسته اند. همچنین این مطالعه نشان داد که برگ گیاه Daphne ginidium دارای ترکیبات فلاونوئیدی و فنولی می‌باشد. جنس دافنه دارای تعداد زیادی از انواع متابولیت‌های ثانویه می‌باشد که بیشتر این ترکیبات مربوط به کومارین، فلاونوئیدها، لیگنان‌ها و استروئیدها است که در قسمت‌های برگ و ساقه این گیاه موجود می‌باشد.بر اساس مطالعه Tiwari و همکاران(28) علت فعالیت بیشتر عصاره‌های اتانولی، وجود پلی فنول‌های تولید شده می‌باشد که منجر به تأثیرگذاری بیشتر در دیواره سلولی و حل شدن ذرات غیر قطبی می‌شوند. در حالی که عصاره آبی- الکلی و عصاره آبی فعالیت کمتری دارند. مشخص شده است که حلال‌های آلی خاصیت ضدمیکروبی بیشتری را اعمال می‌کنند و فعالیت کم عصاره‌های آبی به علت غلظت کم ترکیبات فنولی محلول در آب می‌باشد. در مقایسه بین قسمت‌های مختلف گیاه (برگ، ساقه، مخلوط) در دو فصل بهار و تابستان، مخلوط برگ و ساقه بهار عملکرد بهتری را نشان می‌دهد. در روش انتشار دیسک برگ بهار بیشترین تأثیرگذاری را داشته است که می توان گفت به این علت است که در فصل بهار ترکیبات رزینی موجود در گیاهان افزایش می‌یابد. 

نتیجه گیری

یافته های این مطالعه نشان داد که قسمت های مختلف گیاه D.Oleoides  دارای اثرات ضد میکروبی بر علیه باکتری های ایجاد کننده عفونت های دندانی در شرایط آزمایشگاهی می باشد. بنابراین، با توجه به اهمیت این موضوع، تحقیقات برروی گیاه D.Oleoides دارای ارزش تحقیقی و صنعتی زیادی است و می‌تواند درآینده با به کارگیری روش های مختلف و بهینه سازی تکنیک های استفاده از D.Oleoides برای درمان بیماری‌های دهان و دندان استفاده شود.

تشکر و قدردانی

از کلیه عزیزانی که ما را در اجرای این پژوهش یاری کردند، تقدیرو تشکر می نماییم.

1.       Fayaz M, Sivakumaar PK, Joe MM. Prevalence and antibiotic susceptibility pattern of dental biofilm forming bacteria. Int J Curr Microbiol App Sci 2014; 3(5):46-50.
2.       Nouri Gharajalar S, Emamverdizade P. Detection of betalactamase production among Staphylococcus aureus isolated from human dental plaques using iodometric and molecular methods. J Shahid Sadoughi Univ Med Sci 2018; 25(10):790-9.
3.       Hale FA. Dental caries in dog. Can Vet J 2009; 50(12):1301-4.
4.       Zambori C, Tirziu E, Nichita I, Cumpanasoiu C, Gros RV, Seres M, et al. Biofilm implication in oral diseases of dogs and cats. J Anim Sci Biotechnol 2012; 45(2):208-12.
5.       Houshmand B, Mortazavi H, Alikhani Y, Abdolsamadi H, AhmadiMotemayel F, ZareMahmoudabadi R. In vitro evaluation of antibacterial effect of myrtus extract with different concentrations on some oral bacteria. J Mashhad Dent Sch 2011; 35(2):123-30.
6.       Wright GD. Something old, something new: revisiting natural products in antibiotic drug discovery. Can J Microbiol 2014; 60(3):147-54.
7.       Sengupta S, Chattopadhyay MK, Grossart HP. The multifaceted roles of antibiotics and antibiotic resistance in nature. Front Microbiol 2013; 4:47.
8.       Tayoub G, Abu A, Shamma M. Microbial inhibitory of the Daphne oleifolia lam Ethanolic extract. Int J Med Aromatic Plants 2012; 2(1):161-6.
9.       Buhner SH. Herbal antibiotics: natural alternatives for treating drug-resistant bacteria. North Adams: Storey Publishing; 2012.
10.    Bolouri ME, Hemati K, Bashiri SZ, Mashayekhi K. Effect of harvest time and root diameter on Glycyrrhizin content in Glycyrrhiza glabra. J Plant Prod 2009; 16(2):29-45.
11.    Hedayati S, Azizi F. The effect of daphne mucronata extract on tnf-α and its receptors on cultured human monocytes. Cell J 2005; 3(16):152-7.
12.    Uysal A, Zengin G, Aktumsek A, Rigano D, Senatore F, Sanda MA. Daphne oleoides: an alternative source of important sesquiterpenes. Int J Food Prop 2017; 20(3):549-59.
13.    Gürbüz İ, Demirci B, Franz G, Başer KH, Yeşilada E, Demirci F. Comparison of the volatiles of Daphne pontica L. and D. oleoides Schreber subsp. oleoides isolated by hydro-and microdistillationmethods. Turk J Biol 2013; 37(1):114-21.
14.    Mahon CR, Manuselis G. Textbook of diagnostic microbiology. Philadelphia: Saunders; 1995.
15.    Mahmoudi H, Arabestani MR, Mousavi SF, Alikhani MY. Molecular analysis of the coagulase gene in clinical and nasal carrier isolates of methicillin-resistant Staphylococcus aureus by restriction fragment length polymorphism. J Glob Antimicrob Resist 2017; 8:41-5.
16.    Marouf SH, Rezk A. The role of lesser grain borer in transmission of pathogenic bacteria to poultry and animal feed. Merit Res J Med Med Sci 2015; 3(8):306-14.
17.    Rahmandoost S, Amini K. Identification of streptococcus mutans isolated from dental plaques based on the presence of gtfB gene. J Isfahan Med Sch 2015; 33(356):1804-9.
18.    Saderi H, Owlia P. Detection of multidrug resistant (MDR) and extremely drug resistant (XDR) P. aeruginosa isolated from patients in Tehran, Iran. Iran J Pathol 2015; 10(4):265.
19.    Karamolah KS, Mousavi F, Mahmoudi H. Antimicrobial inhibitory activity of aqueous, hydroalcoholic and alcoholic extracts of leaves and stem of Daphne mucronata on growth of oral bacteria. GMS Hyg Infect Control 2017; 12:1-10.
20.    Mahmoudi H, Arabestani MR, Molavi M, Karamolah K, Fahim N. The study effects antimicrobial of Foeniculum vulgare mill and Achilles mille folium plant on bacterial pathogens causing urinary tract infections and nosocomial infection. Int J Pharmacogn Phytochem Res 2016; 8(9):1549-54.
21.    Avijgan M, Saadat M, Nilfrooshzadeh MA, Hafizi M. Anti fungal effect of Echinophora platyloba extract on some common dermathophytes. J Med Plant 2006; 5(18):10-6.
22.    Clark AM. Natural products as a resource for new drugs. J Pharm Res 1996; 13(8):1133-41.
23.    Dholwani K, Saluja A, Gupta A, Shah D. A review on plant-derived natural products and their analogs with anti-tumor activity. Indian J Pharmacol 2008; 40(2):49.
24.    Javidnia K, Miri R, Jahromi RB. A preliminary study on the biological activity of Daphne mucronata Royle. DARU J Pharm Sci 2003; 11(1):28-1.
25.    Manojlović NT, Mašković PZ, Vasiljević PJ, Jelić RM, Jusković MŽ, Sovrlić M, et al. HPLC analysis, antimicrobial and antioxidant activities of Daphne cneorum L. Hemijska Industrija 2012; 66(5):709-16.
26.    Khosravi A, Malecan M. Effects of lavandula stoechas extracts on staphylococcus aureus and other gram negative bacteria. J Qazvin Univ Med Sci 2004; 7(5):3-9.
27.    Cottigli F, Loy G, Garau D, Floris C, Caus M, Pompei R, et al. Antimicrobial evaluation of coumarins and flavonoids from the stems of Daphne gnidium L. Phytomedicine 2001; 8(4):302-5.
28.    Tiwari P, Kumar B, Kaur M, Kaur G, Kaur H. Phytochemical screening and extraction: a review. Int Pharm Sci 2011; 1(1):98-106.